X- ja y-kromosomien rekombinaatio

Seuraa 
Viestejä8692
Liittynyt20.7.2007

Kaupallisen geenitestaajan FamilytreeDnan ydna-projekti osoittaa x- ja y-kromosomien pystyvän rekombinaatioon. Onko tämä osoitus X- ja y-kromosomien yhteysestä alkupersätä ja siis sukupuolten eriytymisestä suvuttomasta olennosta?

B S posted the following new SNP results on Rootsweb with Thomas Krahn's permission.
In the Walk on the Y investigation, Thomas found that B's father carried a SNP that had been transported to the Y from the X chromosome. I thought I would post the results here because we are more inclined to discuss crossover recombinations in this forum. We have many people here who are used to talking about the X and autosomal haploblocks.

Thomas said:

Here is an interesting comparison in between some sequences in the L88 region:

CACCAATGTCCTTATTTTTTAGTGAAGAAGAGAAAGAACAG HUGO ChrY:16105230..16105270
CACCAACATCCTGGTTTCATAGTGAGGAAGAGAAAGAATGG HUGO ChrX:7133280..7133320
CACCAACATCCTGGTTTCATAGTGAAGAAGAGAAAGAACAG GRC017069 (hg E-M2)
CACCAACATCCTGGTTTCATAGTGACGAAGAGAAAGAACAG GRC002670 (hg J-L26/L27*)
......^.................................. L88/rs3966071
.......^................................. rs4048730
............^............................ rs4048731
.............^........................... rs4048732
.................^....................... unnamed SNP ChrY:16105247 T/C
..................^...................... rs4048733
.........................^............... rs12859783 tri-allelic SNP ChrY:16105255 A/C/G
......................................^^^ from here ChrX starts to be completely different
There is certainly no doubt that your dad has received the polymorphisms through an independent X-Y recombination event than hg E-M2.

It looks like the recombination process traveled from left to right and crunched at the position where the ChrX sequence starts to get different from the Y. The C allele at rs12859783 is coming from a different X-haploblock than the G observed in the ChrX HUGO sequence.

The A allele may have happened independently in the early days of the human Y chromosome. The recombination event in E-M2 stopped before this position and maintained the A allele from the Y chromosome.

In conclusion we need to add two new L markers to the list:
L197 = ChrY:16105247 T to C in order to give it a unique name.
L198 = ChrY:16105255 A to C as a new UEP downstream of J-L26/L27

end Thomas Krahn's explanation

Takuutestattu suomalainen. Aboriginaali Finlandian asukas.

Blogi: http://terheninenmaa.blogspot.fi

Kommentit (2)

Vierailija
sigfrid
Kaupallisen geenitestaajan FamilytreeDnan ydna-projekti osoittaa x- ja y-kromosomien pystyvän rekombinaatioon. Onko tämä osoitus X- ja y-kromosomien yhteysestä alkupersätä ja siis sukupuolten eriytymisestä suvuttomasta olennosta?

Ainakin se vahvistaa kyseistä teoriaa, joka muutenkin on jo aika lailla ainoa varteenotettava näkemys aiheesta. Mielenkiintoinen tieto muuten, en muista olenko aiemmin törmännyt.

creep
Seuraa 
Viestejä292
Liittynyt10.9.2009

X ja Y pariutuvat nisäkkäillä keskenään meioosissa käytännössä samoin kuin muutkin vastinkromosomiparit. Näin on tapahduttava, jotta kromosomien segregaatio (kumpaankin syntyvään tytärsoluun tulee vain toinen vastinkromosomeista) onnistuu. Siksi niissä on näitä toisiaan muistuttavia alueita.

Toki sitä rekombinaatiotakin niiden välillä on tiedetty tapahtuvan, sen yleisyydestä en osaa sanoa, eikä siitä tuossa Sigfridin lainaamassa tekstissäkään mainittu. Äkkiseltään voisi ajatella rekombinaation X:n ja Y:n välillä johtavan usein melkoisiin ongelmiin, ja siten kelvottomiin sukusoluihin, jotka harvoin johtavat alkion selviytymiseen. Eiköhän nuo XX-mies ja XY-nainen tapaukset ainakin osin johdu sukupuolikromosomien välillä tapahtuneesta rekombinaatiosta, vaikka muitakin syitä on.

Uusimmat

Suosituimmat