Signeeraus geneettisessä koodissa?

Seuraa 
Viestejä45973
Liittynyt3.9.2015

Olen silloin tällöin törmännyt sellaisen vaatimuksen esittämiseen, että (jos geneettistä koodia on suunniteltu,) suunnittelijan olisi pitänyt kirjoittaa signeerauksensa geneettiseen koodiin, esim. tyyliin "made by God" tms.

Vaatimuksena todisteeksi suunnittelusta esitetään siis usein tällöin, että pitäisi löytää jokin edellä mainitun kaltainen teksti geneettisestä koodista.

Kysynkin nyt - etenkin niiltä, jotka edellä mainittua vaatimusta pitävät oikeutettuna - että
kelpaisiko tämän näköinen koodi(?):

GGCGUGAACAAUGUCCCAUGAGACGUAUGCACUGCUGAAACCAGUGAUGCCAAGUAAUGUCGAGA
AACUGCUUUCACAUUCUCUUUUAGAUGUGCCAGUGCCCCAUGACCGACGUAUUCUGCCCAAUGGAC
GCGUUUCUACAAUUAACACACUGCCCCAUGUAAUUCCACAUUCAAGUCCUUUUCCAUUUCUUCCACUA

JOS EI, MIKSI EI?

Sivut

Kommentit (39)

salai
Seuraa 
Viestejä7264
Liittynyt17.3.2005

Tuolla (esim.) on tuollainen taulu:
The Genetic Code
Onko tuossa lopetuskoodi ensimmäisenä (en ole asiantuntija)? Eli luoja olisi kirjoittanut takaperin: "Kilroy was here"?

Onko se muuten totta, että tietyssä paikkaa piin desimaaleja näkyy ns. luojan kasvot bittikarttana?

Mitä tahansa edellä esitetyistä väitteistä saa epäillä ja ne voidaan muuttaa toisiksi ilman erillistä ilmoitusta. Kirjoittaja pyrkii kuitenkin toimimaan rehellisesti ja noudattamaan voimassa olevia lakeja.

Vierailija

No, koko vaatimus signeerauksestahan on jo itsessään typerä: se edellyttää, että mitään teosta tai keksintöä ei voi olla olemassa, ilman että siihen on kirjoitettu tekijän nimi. Päätelmän voi todistaa vääräksi piirtämällä A4-paperille tikku-ukon, ja näyttää signeeramatonta paperia kaverilleen.

Vierailija
salai
Onko se muuten totta, että tietyssä paikkaa piin desimaaleja näkyy ns. luojan kasvot bittikarttana?

Toki on totta.

MrKAT
Seuraa 
Viestejä2278
Liittynyt16.3.2005
analyysi
Olen silloin tällöin törmännyt sellaisen vaatimuksen esittämiseen, että (jos geneettistä koodia on suunniteltu,) suunnittelijan olisi pitänyt kirjoittaa signeerauksensa geneettiseen koodiin, esim. tyyliin "made by God" tms.

Vaatimuksena todisteeksi suunnittelusta esitetään siis usein tällöin, että pitäisi löytää jokin edellä mainitun kaltainen teksti geneettisestä koodista.

Kysynkin nyt - etenkin niiltä, jotka edellä mainittua vaatimusta pitävät oikeutettuna - että
kelpaisiko tämän näköinen koodi(?):

GGCGUGAACAAUGUCCCAUGAGACGUAUGCACUGCUGAAACCAGUGAUGCCAAGUAAUGUCGAGA
AACUGCUUUCACAUUCUCUUUUAGAUGUGCCAGUGCCCCAUGACCGACGUAUUCUGCCCAAUGGAC
GCGUUUCUACAAUUAACACACUGCCCCAUGUAAUUCCACAUUCAAGUCCUUUUCCAUUUCUUCCACUA

JOS EI, MIKSI EI?


Ihanaa..koodeja..grraahgl(Homerimaista korahtelua)..
Translitteroidaan proteiinisymboleiksi:

GGCGUG AACAAU GUCCCA UGAGAC
G V N N V P Stop D

GUAUGC ACUGCU GAAACC AGUGAU
V C T A E T S D

GCCAAG UAAUGU CGAGAA ACUGCU
A K StopC R E T A

UUCACA UUCUCU UUUAGA UGUGCC
F T F S F R C A

AGUGCC CCAUGA CCGACG UAUUCU
S A P Stop P T Y S

GCCCAA UGGACG CGUUUC UACAAU
A Q W T R F Y N

UAACAC ACUGCC CCAUGU AAUUCC
StopH T A P C N S

ACAUUC AAGUCC UUUUCC AUUUCU
T F K S F S I S

UCCACU A
S T ?

Ei ainakaan tuo vakuuttanut. Joku toinen saa tehdä deleetion ja insertion DNA-koodiin ja kokeilla tuleeko mitä tekstiä..
Kirjaimet ARNDCQEGHILKMFPSTYVStopStart täältä
http://en.wikipedia.org/wiki/Genetic_code

Joku geneettinen yhtiö on koodannut nimensä DNA:han coyrightina.

Jos joku löytää toistuvasti DNA:stani:
"...AUG CGU AAA GCU ACU GUU GCU UUA GAA CAU ACU GAA UUA GAA GAA UAG ..."
eli "... MRKAT VALEHTELEE Stop MRKAT VALEHTELEE Stop ..."
niin minä olen valmis putoamaan tuolilta

O puuttuu mutta voi käyttää Q:ta ja V:ta luovasti Roomalaiseen tapaan:
"GQD NQT EKSIST" "IAM GQD" "IAM YQVR QNLY GQD, YAHWE"

Homeopatia-skandaali A-talkissa: https://www.youtube.com/watch?v=qXLTz5LhHMU

MrKAT
Seuraa 
Viestejä2278
Liittynyt16.3.2005
salai

Onko se muuten totta, että tietyssä paikkaa piin desimaaleja näkyy ns. luojan kasvot bittikarttana?

Jos sen ajattelee satunnaislukuna äärettömän pitkänä, niin miksei.

PII = 3.1415926535897932384626433..
kohdasta 69'871'281.:nnestä desimaalista:
...7575940468633596463316091821 18661669141914882437..
löytyy peruskoodattuna (01=A 02=B..)
sana "PIRU" =(16 09 18 21)

Sanoja JUMALA tai JEESUS ei näkynyt ainakaan
ensimmäisten 100 miljoonan desimaalin joukossa.

"PIRU" löytyy myös ascii-koodattuna (65=A, 66=B,..)
(80 73 82 85) peräti ainakin kahdesta kohtaa
15'995 795. kohdasta ja 73'449 130. kohdasta.

JUMALA:a ja JEESUS:ta ei näy tätenkään.

Kyllä PIRU on nyt niskan päällä 3-0 tässä maailmankaikkeudessa.

Homeopatia-skandaali A-talkissa: https://www.youtube.com/watch?v=qXLTz5LhHMU

salai
Seuraa 
Viestejä7264
Liittynyt17.3.2005

Mitä me tässä turhaan ihmetellään, kun foorumilla on todellinen asiantuntijakin: Kielellinen DNA on: AEEREECE CEEEERAE

Mitä tahansa edellä esitetyistä väitteistä saa epäillä ja ne voidaan muuttaa toisiksi ilman erillistä ilmoitusta. Kirjoittaja pyrkii kuitenkin toimimaan rehellisesti ja noudattamaan voimassa olevia lakeja.

MrKAT
Seuraa 
Viestejä2278
Liittynyt16.3.2005

Viritelkäähän jo mattojanne ja Suunto-kompassejanne Mekan etsintään.

NCBI:n geenipankista DNA+proteiiniarkistoista löysin valtavasti "ALLAH"-koodauksia jo pelkästään ihmisen proteiineista (about 100, joista suuri osa täydellisenä). Esim näyte luettelosta:

---------------------------------------------------------------------------------
"seizure related 6 homolog [Homo sapiens]
Length=994 Score = 18.0 bits (35), Expect = 931 Identities = 5/5 (100%), Positives = 5/5 (100%), Gaps = 0/5 (0%)

Query 1 ALLAH 5
ALLAH
Sbjct 14 ALLAH 18

>gi|15026974|emb|CAC44768.1| obscurin [Homo sapiens]
Length=6620 Score = 18.0 bits (35), Expect = 931 Identities = 5/5 (100%), Positives = 5/5 (100%), Gaps = 0/5 (0%)

Query 1 ALLAH 5
ALLAH
Sbjct 218 ALLAH 222

---------------------------------

potassium voltage-gated channel, subfamily H, member 8 [Homo sapiens]
Length=1107 Score = 18.0 bits (35), Expect = 931 Identities = 5/5 (100%), Positives = 5/5 (100%), Gaps = 0/5 (0%)

Query 1 ALLAH 5
ALLAH
Sbjct 364 ALLAH 368
---------------------------------------------------------------------------

ALLAH säätelee kalium-jännite-porttikanavia hermoissamme.. hmmm

Homeopatia-skandaali A-talkissa: https://www.youtube.com/watch?v=qXLTz5LhHMU

Vierailija

Telomeerit ovat copyright-tekstit. Ne tippuvat vähitellen meijoosien takia kokonaan pois. Lopulta voidaan sanoa vanhasta ihmisestä, että hän on "Jumalan hylkäämä".

John Carter
Seuraa 
Viestejä7532
Liittynyt17.2.2006

ASCII kieli

66+73+76+76+71+65+84+69+83+3
B I L L G A T E S 3

666

Tämä oli taas yksi tällainen"todiste" microsoftin pedonomaisuudesta.

Näitä leikkejä on netti turhankin pullollaan.

" Käsittämätöntä luonnossa on sen käsitettävyys. " Albert Einstein

Vierailija

Geneettisestä koodista :

Geneettinen koodi estää kasvia tai eläintä etääntymästä liiaksi keskitasosta. Vaihtelua voi kyllä esiintyä melkoisesti kuten voidaan nähdä esimerkiksi ihmisistä, kissoista tai koirista

Tiedemiehet ovat yrittäneet jatkuvasti muuttaa eri eläimiä ja kasveja loputtomasti risteytyksillä. He ovat halunneet nähdä, pystyisivätkö he ajan oloon kehittämään uusia eliömuotoja. Millaisia tuloksia he ovat saavuttaneen? On Call -lehdessä kerrotaan: ”Jalostajat havaitsevat tavallisesti, että muutaman sukupolven kuluttua jalostuksessa saavutetaan ääriraja, jota pitemmälle edistyminen ei ole mahdollista, eikä ole muodostunut yhtään uutta lajia – –. Jalostuskokeet näyttäisivät sen tähden pikemminkin kumoavan kehitysteorian kuin tukevan sitä.”

Science-lehdessä todetaan samaan tapaan: ”Lajeissa voi tosiaankin tapahtua vähäisiä muutoksia niiden fyysisissä ja muissa ominaisuuksissa, mutta se on rajallista ja pitemmän ajan kuluessa vaihteluskaala on jotakuinkin olematon.” Eliöt eivät siis saa perinnökseen mahdollisuutta muuttua jatkuvasti, vaan sen sijaan 1) pysyvyyden ja 2) rajallisen muuntelualan.

Niinpä kirjassa Molecules to Living Cells todetaankin: ”Porkkanasta tai hiiren maksasta irrotetut solut ovat lukemattomien jakautumiskertojen jälkeenkin yhä porkkanan soluja tai hiiren maksasoluja.” Kirjassa Symbiosis in Cell Evolution sanotaan: ”Kaikki elämä – – lisääntyy uskomattoman uskollisesti.” Myös tiedelehti Scientific American huomauttaa: ”Eliöt ovat tavattoman monimuotoisia, mutta jokainen muoto pysyy hämmästyttävän muuttumattomana omassa haarassaan: siat pysyvät sikoina ja tammet tammina sukupolvesta toiseen.”
Muuan tiedetoimittaja: ”Ruusupensaisiin puhkeaa aina ruusunkukkia, ei koskaan kamelioita. Ja vuohet synnyttävät vuohia, eivät koskaan lampaita.” Hän teki sen johtopäätöksen, että mutaatiot ”eivät voi selittää koko evoluutiota – sitä miksi on olemassa kaloja, matelijoita, lintuja ja nisäkkäitä”.

Lajinsisäinen muuntelu selittää erään seikan, joka vaikutti Darwinin alkuperäisiin käsityksiin evoluutiosta. Ollessaan Galápagossaarilla hän tarkkaili saarten peippoja. Ne olivat ilmeisesti muuttaneet Etelä-Amerikan mantereelta ja olivat samaa lajia kuin niiden mantereella elävä kantamuoto. Niissä oli kuitenkin merkillisiä eroja, muun muassa nokan muodossa. Darwin tulkitsi sen osoitukseksi käynnissä olevasta evoluutiosta. Mutta todellisuudessa kyseessä oli vain yksi esimerkki lajinsisäisestä muuntelusta, jota voi tapahtua eliön perintötekijöiden sallimissa rajoissa. Peipot pysyivät peippoina. Ne eivät olleet muuttumassa joksikin muuksi, eivätkä ne koskaan muutukaan.
Johtopäätös on selvä. Vaikka perintötekijöissä tapahtuisi kuinka paljon sattumanvaraisia muutoksia tahansa, ne eivät saa mitään eliölajia muuttumaan toiseksi lajiksi. Ranskalainen biologi Jean Rostand kirjoittaa: ”En voi mitenkään pakottaa itseäni ajattelemaan, että nämä perintötekijöiden ’lipsahdukset’ olisivat voineet luonnonvalinnan avullakaan, edes käyttämällä hyväkseen niitä suunnattomia ajanjaksoja, jotka evoluutio vaatii muodostaakseen elämää, saada aikaan koko maailmaa, sen tuhlailevia rakenteita, sen hienouksia ja sen hämmästyttäviä ’sopeutumia’.”

Myös perinnöllisyystieteilijä C. H. Waddington toteaa mutaatioihin uskomisesta: ”Tämä on samanlaista teoriaa kuin kuvittelisi, että jos otamme mitkä tahansa neljätoista riviä järkevää englantia ja vaihdamme kirjaimen kerrallaan sekä hyväksymme vain ne osat, joissa yhä on järkeä, niin syntyy lopulta yksi Shakespearen soneteista. – – minusta sellainen on mielisairaan logiikkaa, ja olen sitä mieltä, että meidän pitäisi pystyä parempaan.”

Professori John Moore paljastaa totuuden sanoessaan: ”Huolellisen tarkastelun ja analysoinnin jälkeen jokainen dogmaattinen väite – –jonka mukaan geenimutaatiot ovat jonkin luonnonvalintaan liittyvän evoluutioprosessin raaka-ainetta, on satujen sepittämistä.”

Vierailija

Mutaatioista:

EVOLUUTIOON liittyy vielä eräs ongelma. Miten sen oletetaan tarkasti ottaen tapahtuneen? Mikä on yksi niistä perusmekanismeista, joiden arvellaan tehneen mahdolliseksi jonkin eliötyypin kehittymisen toiseksi eliötyypiksi? Kehitysteorian kannattajat sanovat, että erilaisilla solutumassa tapahtuneilla muutoksilla on ollut osuutensa asiassa. Ja huomattavimpia näistä muutoksista ovat ”sattumalta” tapahtuneet muutokset, joista käytetään nimitystä mutaatiot. Erityisesti sukusolujen geenien ja kromosomien uskotaan liittyvän mutaatioiden aiheuttamiin muutoksiin, koska niissä tapahtuvat mutaatiot voivat siirtyä jälkeläisiin.

”Evoluution perustana ovat mutaatiot”, sanotaan Spectrum-tietosanakirjassa. Paleontologi Steven Stanley sanoo mutaatioita samaan tapaan evoluution ”raaka-aineiksi”. Perinnöllisyystieteilijä Peo Koller puolestaan selittää, että mutaatiot ”ovat välttämättömiä lajinkehitykselle”.

Evoluutiolle eivät kuitenkaan kelpaa millaiset mutaatiot hyvänsä. Robert Jastrowin mukaan tarvitaan ”edullisten mutaatioiden hidasta kasaantumista”. Ja Carl Sagan lisää: ”Mutaatiot – äkilliset muutokset perinnöllisyydessä – lisääntyvät tyyppinsä mukaisesti. Ne ovat evoluution raaka-ainetta. Ympäristö valitsee ne harvat mutaatiot, jotka edistävät elossa säilymistä, ja näin tapahtuu sarja hitaita muutoksia eliömuodosta toiseksi, uuden lajin aluksi.”

On myös sanottu, että mutaatiot saattavat olla yksi selitys niihin nopeisiin muutoksiin, jotka liittyvät ”jaksoittaisten tasapainotilojen” teoriaan. John Gliedman kirjoittaa eräässä tiedelehdessä: ”Evoluutio-opin uudistajat uskovat tärkeimmissä säätelygeeneissä tapahtuvien mutaatioiden olevan juuri niitä geneettisiä työkaluja, joita heidän ’suurten hyppyjen’ teoriansa edellyttää.” Englantilainen eläintieteilijä Colin Patterson huomauttaa kuitenkin: ”Teorioita voi vapaasti rakennella. Me emme tiedä mitään näistä pääsäätelygeeneistä.” Mutta jos jätämme tällaisen teorioinnin sikseen, niin yleisesti oletetaan, että niin sanotut kehitysopilliset mutaatiot ovat pieniä sattumanvaraisia muutoksia, jotka kasaantuvat pitkän ajan kuluessa.

Miten mutaatiot syntyvät? Useimpien niistä arvellaan syntyvän tavanomaisessa solunjakautumisessa. Kokeet ovat kuitenkin osoittaneet, että niitä voivat aiheuttaa myös ulkopuoliset tekijät, esimerkiksi säteily ja kemikaalit. Kuinka usein niitä sitten sattuu? Perimäaineksen jakautuminen solussa on huomattavan säännönmukaista. Ottaen huomioon eliössä jakautuvien solujen määrän mutaatioita sattuu suhteellisen harvoin. Encyclopedia Americana -tietosanakirjassa todetaankin, että ”niiden DNA-nauhojen kahdentuminen, joissa geenit ovat, tapahtuu erittäin täsmällisesti. Paino- tai kopiointivirheet ovat harvinaisia onnettomuuksia.”

Onko niistä hyötyä vai haittaa?

Jos hyödylliset mutaatiot ovat evoluution perusta, niin kuinka suuri osa niistä on hyödyllisiä? Tästä asiasta kehitysopin kannattajat ovat hämmästyttävän yksimielisiä. Esimerkiksi Carl Sagan sanoo: ”Useimmat niistä ovat vahingollisia tai tappavia.” Myös Otavan suuressa ensyklopediassa huomautetaan: ”Valtaosa uusista mutaatioista on kantajansa elinkykyä heikentäviä.” Peo Koller puolestaan sanoo: ”Suurin osa mutaatioista on haitallisia yksilöille, joilla on muuntunut geeni. Kokeissa havaittiin, että jokaista edullista tai hyödyllistä mutaatiota kohti on useita tuhansia haitallisia mutaatioita.”

Jos ei siis oteta huomioon elinkyvyn kannalta ”neutraaleja” mutaatioita, niin jokaista hyödylliseksi väitettyä mutaatiota kohti on tuhansia vahingollisia mutaatioita. ”Missä tahansa monimutkaisessa järjestelmässä tapahtuvien sattumanvaraisten muutosten voidaan odottaakin johtavan tällaisiin tuloksiin”, todetaan Encyclopædia Britannicassa. Siksi mutaatioiden sanotaan olevan syynä satoihin sairauksiin, joissa perintötekijöillä on ratkaiseva osuus.

Mutaatioiden vahingollisuuden vuoksi Encyclopedia Americana tunnustaa: ”Sitä, että useimmat mutaatiot ovat eliölle haitallisia, näyttää olevan vaikea sovittaa näkemykseen, jonka mukaan mutaatiot ovat evoluution raaka-ainelähde. Biologian oppikirjoissa kuvatut mutantit ovat todellakin epämuodostumia ja luonnottomuuksia, ja kaikesta päättäen mutaatio pikemminkin tuhoaa kuin rakentaa.” Kun mutanttihyönteiset pantiin kilpailemaan normaalien hyönteisten kanssa, tulos oli aina samanlainen. G. Ledyard Stebbins huomauttaakin: ”Ennemmin tai myöhemmin ilmaantuu sukupolvi, josta mutantit ovat karsiutuneet pois.” Ne eivät voineet menestyä, koska ne eivät olleet edistyneet vaan olivat rappeutuneita ja sen vuoksi epäedullisessa asemassa.

Sivut

Uusimmat

Suosituimmat