Signeeraus geneettisessä koodissa?

Seuraa 
Viestejä45973
Liittynyt3.9.2015

( Esitin tämän kysymyksen jo "Evoluutio ja fossiilit"-otsakkeen alla, mutta kun vastauksia alkuperäiseen kysymykseen ei ole juuri kuulunut, niin ajattelin esittää kysymyksen myös tämän (Geenit ja biotekniikka) otsakkeen alla, jolle kysymys ehkä aiheensa puolesta paremmin soveltuukin.(Ks. alkuperäinen kysymykseni: http://www.tiede.fi/keskustelut/viewtopic.php?t=5568 ) Vastata voi joko alkuperäiseen ketjuun, tai sitten tänne.)

*****

Olen silloin tällöin törmännyt sellaisen vaatimuksen esittämiseen, että (jos geneettistä koodia on suunniteltu,) suunnittelijan olisi pitänyt kirjoittaa signeerauksensa geneettiseen koodiin, esim. tyyliin "made by God" tms.

Vaatimuksena todisteeksi suunnittelusta esitetään siis usein tällöin, että pitäisi löytää jokin edellä mainitun kaltainen teksti geneettisestä koodista.

Kysynkin nyt - etenkin niiltä, jotka edellä mainittua vaatimusta pitävät oikeutettuna - että
kelpaisiko tämän näköinen koodi(?):

GGCGUGAACAAUGUCCCAUGAGACGUAUGCACUGCUGAAACCAGUGAUGCCAAGUAAUGUCGAGA
AACUGCUUUCACAUUCUCUUUUAGAUGUGCCAGUGCCCCAUGACCGACGUAUUCUGCCCAAUGGAC
GCGUUUCUACAAUUAACACACUGCCCCAUGUAAUUCCACAUUCAAGUCCUUUUCCAUUUCUUCCACUA

JOS EI, MIKSI EI?

Sivut

Kommentit (41)

Heksu
Seuraa 
Viestejä5463
Liittynyt16.3.2005

Voisitko translitteroida tuon nykysuomelle tai jollekin muulle, niin että tavallisetkin ihmiset ymmärtävät? Miksi juuri se pitäisi tulkita joksikin allekirjoitukseksi?

Vierailija

Heksu, en ala "translitteroida nykysuomelle" edellä kirjoittamaani koodia. Sitä koodipätkää on moni yrittänyt "avata", mutta kukaan ei ole tietääkseni siinä vielä onnistunut. Vastauksen siihen kysymykseen, onko kyseessä "hatusta vedetty" koodi, vaiko tarkasti valittu, signeeraukseen (joidenkin perusteltavissa olevien syiden johdosta) viittaava koodi, jätän avoimeksi. Siihen odotan siis TEILTÄ vastauksia, kelpaisiko tuollainen koodi todisteeksi signeerauksesta ja sitä kautta suunnittelusta...

Vierailija

Kuten sanottua, esittämäsi _vaatimus todisteeksi suunnittelijasta_ (signeeraus), on kansankielellä sanottuna ns. "vitun typerä". Miksi teos tarvitsisi allekirjoittajan ollakseen suunniteltu?

Neutroni
Seuraa 
Viestejä26890
Liittynyt16.3.2005
analyysi

Kysynkin nyt - etenkin niiltä, jotka edellä mainittua vaatimusta pitävät oikeutettuna - että
kelpaisiko tämän näköinen koodi(?):

GGCGUGAACAAUGUCCCAUGAGACGUAUGCACUGCUGAAACCAGUGAUGCCAAGUAAUGUCGAGA
AACUGCUUUCACAUUCUCUUUUAGAUGUGCCAGUGCCCCAUGACCGACGUAUUCUGCCCAAUGGAC
GCGUUUCUACAAUUAACACACUGCCCCAUGUAAUUCCACAUUCAAGUCCUUUUCCAUUUCUUCCACUA

JOS EI, MIKSI EI?

Tuohan kuulostaa pelottavan tutulta, sehän on ilmiselvää muinaissuomea. Nyt alkaa näyttää vahvasti siltä, että eräs tämän palstan kirjoittaja on tuo älykäs suunnittelija. Tai ainakin suunnittelija.

Vierailija
analyysi
Olen silloin tällöin törmännyt sellaisen vaatimuksen esittämiseen, että (jos geneettistä koodia on suunniteltu,) suunnittelijan olisi pitänyt kirjoittaa signeerauksensa geneettiseen koodiin, esim. tyyliin "made by God" tms.

Vaatimuksena todisteeksi suunnittelusta esitetään siis usein tällöin, että pitäisi löytää jokin edellä mainitun kaltainen teksti geneettisestä koodista.


1) Miksi olisi pitänyt signeerata?

2) Miksi signeeraus olisi oltava tekstiä?

Vierailija

Signeerauksen pitäisi olla niin pitkä että sen esiintymistodennäköisyys olisi äärettömän pieni ja se pitäisi löytyä elävistä lajeista, mielellään mahdollisimman monesti. Ongelmahan on siinä, että nukleotidien vuorottelu pitäisi kääntää jotenkin merkitykselliselle kielelle ja sopivasti jotain systeemiä miettimällä varmasti löytyisi jotain kiinnostavaa. Sitten kiisteltäisiin mitä järkeä on kyseisessä algoritmissa ja kielen merkityksessä jos jotain löytyisi. En itse olisi ainakaan vakuuttunut, samaa jumalan loittonemista ja etsimistä kuin kvanttikohinasta.

Genomista löytyy kyllä nykyäänkin sanoja, jos vaikka katsoo 1-kirjaimisia aminohapposekvenssejä.

Vierailija

Aika selvä viesti täytyisi olla. Aina saadaan randomilla arpomalla sieltä viestejä esiin etc. mutta se että kaveri viittis tulla ihan silleen vaikka laittaa jonkun alkudemon tohon syntymän paikkeille sillee et "Moi oon Jumala." ja sit jotain maisemia ja mahtipontista musaa niin olis homma paljon selvempi!

Vierailija
analyysi

Olen silloin tällöin törmännyt sellaisen vaatimuksen esittämiseen, että (jos geneettistä koodia on suunniteltu,) suunnittelijan olisi pitänyt kirjoittaa signeerauksensa geneettiseen koodiin, esim. tyyliin "made by God" tms.

Vaatimuksena todisteeksi suunnittelusta esitetään siis usein tällöin, että pitäisi löytää jokin edellä mainitun kaltainen teksti geneettisestä koodista.

Kysynkin nyt - etenkin niiltä, jotka edellä mainittua vaatimusta pitävät oikeutettuna - että
kelpaisiko tämän näköinen koodi(?):

GGCGUGAACAAUGUCCCAUGAGACGUAUGCACUGCUGAAACCAGUGAUGCCAAGUAAUGUCGAGA
AACUGCUUUCACAUUCUCUUUUAGAUGUGCCAGUGCCCCAUGACCGACGUAUUCUGCCCAAUGGAC
GCGUUUCUACAAUUAACACACUGCCCCAUGUAAUUCCACAUUCAAGUCCUUUUCCAUUUCUUCCACUA

JOS EI, MIKSI EI?

Ensinnäkin, tuo on RNA:ta. Aika harvan organismin genomi on RNA:ta, paitsi esim. HI-viruksen, joten herää kysymys, mistä eliöstä tämä sekvenssi olisi peräisin. Aika ketku Jumala olisi, jos pelkästään HIV:in omaksensa tunnustaisi?? (Viesti voisi olla vaikka: JAHVELTA TERKKUJA: HAJOTKAA TÄHÄN, LUUSERIT)

Toisekseenkin, sekvenssistä löytyy ainakin yksi avoin lukukehys proteiinille, jonka aminohappojärjestys on:

3'5' Frame 2
S G R N G K G L E C G I T W G S V L I V E T R P L G R I R R S W G T G T S K R E C E S S F S T L L G I T G F S S A Y V S W D I V H A

Tuollaista proteiinia ei löydy BLAST-haulla tietokannoista, mutta proteiinia koodaava DNA on tuskin hyvä salaisten viestien säilytyspaikka, koska niihin vaikuttaa luonnonvalinta. Kyseessä voi pelkästään olla ennestään tuntematon geeni. Ainakin pitäisi selvittää, onko tuo proteiini voinut syntyä luonnonvalinnan kautta.

Kolmanneksi, jos epäillään tuossa pätkässä jotain salaista viestiä olevan, kannattaisi varmaan katsoa onko sekvenssi niin epätodennäköinen, ettei se voisi tulla vastaan sattumalta (jos tarkastellaan kaikkien maailman eliöiden kaikkea DNA:ta).

Vierailija

On mahdollista, että ihmisen ja kaikkien muidenkin lajien perimästä löytyy kosminen tuoteseloste tai muuta hauskaa. Ongelma on siinä että mokoma on mahdoton todistaa oikeaksi tai vääräksi, ainakin ennenkuin saavutamme täydellisen ymmärryksen DNA:sta.

Vierailija

Tarkoitus olisi lähitulevaisuudessa palata tähän aiemmin esittämääni kysymykseen. Niillä, jotka eivät vielä ole vastanneet ja jotka haluavat ottaa asiaan vielä kantaa, on nyt aikaa vielä pari viikkoa vastailla ennen kuin kerron oman näkökantani asiaan.

(Äänestys tässä ketjussa taisi jo päättyä, joten vastauksia kyselyyn voi antaa ilmeisesti enää kirjallisesti.)

Kysymyshän kuului näin:

Olen silloin tällöin törmännyt sellaisen vaatimuksen esittämiseen, että (jos geneettistä koodia on suunniteltu,) suunnittelijan olisi pitänyt kirjoittaa signeerauksensa geneettiseen koodiin...

...kelpaisiko tämän näköinen koodi(?):

GGCGUGAACAAUGUCCCAUGAGACGUAUGCACUGCUGAAACCAGUGAUGCCAAGUAAUGUCGAGA
AACUGCUUUCACAUUCUCUUUUAGAUGUGCCAGUGCCCCAUGACCGACGUAUUCUGCCCAAUGGAC
GCGUUUCUACAAUUAACACACUGCCCCAUGUAAUUCCACAUUCAAGUCCUUUUCCAUUUCUUCCACUA

JOS EI, MIKSI EI?

Vierailija

Jos itse suunnittelisin elämää niin en pistäisi signeereusta työhöni.

Onko tuo koodinpätkäsi edes aito vai ihan vaan heitetty?

Vierailija
Cosmic-Fairy
Jos itse suunnittelisin elämää niin en pistäisi signeereusta työhöni.

Onko tuo koodinpätkäsi edes aito vai ihan vaan heitetty?


Kuten kerroin, palaan lähitulevaisuudessa asiaan.
Silloin tulee vastaus varmaan tuohonkin kysymykseen.

Sivut

Uusimmat

Suosituimmat