Seuraa 
Viestejä45973

( Esitin tämän kysymyksen jo "Evoluutio ja fossiilit"-otsakkeen alla, mutta kun vastauksia alkuperäiseen kysymykseen ei ole juuri kuulunut, niin ajattelin esittää kysymyksen myös tämän (Geenit ja biotekniikka) otsakkeen alla, jolle kysymys ehkä aiheensa puolesta paremmin soveltuukin.(Ks. alkuperäinen kysymykseni: http://www.tiede.fi/keskustelut/viewtopic.php?t=5568 ) Vastata voi joko alkuperäiseen ketjuun, tai sitten tänne.)

*****

Olen silloin tällöin törmännyt sellaisen vaatimuksen esittämiseen, että (jos geneettistä koodia on suunniteltu,) suunnittelijan olisi pitänyt kirjoittaa signeerauksensa geneettiseen koodiin, esim. tyyliin "made by God" tms.

Vaatimuksena todisteeksi suunnittelusta esitetään siis usein tällöin, että pitäisi löytää jokin edellä mainitun kaltainen teksti geneettisestä koodista.

Kysynkin nyt - etenkin niiltä, jotka edellä mainittua vaatimusta pitävät oikeutettuna - että
kelpaisiko tämän näköinen koodi(?):

GGCGUGAACAAUGUCCCAUGAGACGUAUGCACUGCUGAAACCAGUGAUGCCAAGUAAUGUCGAGA
AACUGCUUUCACAUUCUCUUUUAGAUGUGCCAGUGCCCCAUGACCGACGUAUUCUGCCCAAUGGAC
GCGUUUCUACAAUUAACACACUGCCCCAUGUAAUUCCACAUUCAAGUCCUUUUCCAUUUCUUCCACUA

JOS EI, MIKSI EI?

Sivut

Kommentit (41)

Heksu
Seuraa 
Viestejä5463

Voisitko translitteroida tuon nykysuomelle tai jollekin muulle, niin että tavallisetkin ihmiset ymmärtävät? Miksi juuri se pitäisi tulkita joksikin allekirjoitukseksi?

Heksu, en ala "translitteroida nykysuomelle" edellä kirjoittamaani koodia. Sitä koodipätkää on moni yrittänyt "avata", mutta kukaan ei ole tietääkseni siinä vielä onnistunut. Vastauksen siihen kysymykseen, onko kyseessä "hatusta vedetty" koodi, vaiko tarkasti valittu, signeeraukseen (joidenkin perusteltavissa olevien syiden johdosta) viittaava koodi, jätän avoimeksi. Siihen odotan siis TEILTÄ vastauksia, kelpaisiko tuollainen koodi todisteeksi signeerauksesta ja sitä kautta suunnittelusta...

Sisältö jatkuu mainoksen alla
Sisältö jatkuu mainoksen alla

Kuten sanottua, esittämäsi _vaatimus todisteeksi suunnittelijasta_ (signeeraus), on kansankielellä sanottuna ns. "vitun typerä". Miksi teos tarvitsisi allekirjoittajan ollakseen suunniteltu?

Neutroni
Seuraa 
Viestejä34516
analyysi

Kysynkin nyt - etenkin niiltä, jotka edellä mainittua vaatimusta pitävät oikeutettuna - että
kelpaisiko tämän näköinen koodi(?):

GGCGUGAACAAUGUCCCAUGAGACGUAUGCACUGCUGAAACCAGUGAUGCCAAGUAAUGUCGAGA
AACUGCUUUCACAUUCUCUUUUAGAUGUGCCAGUGCCCCAUGACCGACGUAUUCUGCCCAAUGGAC
GCGUUUCUACAAUUAACACACUGCCCCAUGUAAUUCCACAUUCAAGUCCUUUUCCAUUUCUUCCACUA

JOS EI, MIKSI EI?

Tuohan kuulostaa pelottavan tutulta, sehän on ilmiselvää muinaissuomea. Nyt alkaa näyttää vahvasti siltä, että eräs tämän palstan kirjoittaja on tuo älykäs suunnittelija. Tai ainakin suunnittelija.

analyysi
Olen silloin tällöin törmännyt sellaisen vaatimuksen esittämiseen, että (jos geneettistä koodia on suunniteltu,) suunnittelijan olisi pitänyt kirjoittaa signeerauksensa geneettiseen koodiin, esim. tyyliin "made by God" tms.

Vaatimuksena todisteeksi suunnittelusta esitetään siis usein tällöin, että pitäisi löytää jokin edellä mainitun kaltainen teksti geneettisestä koodista.


1) Miksi olisi pitänyt signeerata?

2) Miksi signeeraus olisi oltava tekstiä?

Signeerauksen pitäisi olla niin pitkä että sen esiintymistodennäköisyys olisi äärettömän pieni ja se pitäisi löytyä elävistä lajeista, mielellään mahdollisimman monesti. Ongelmahan on siinä, että nukleotidien vuorottelu pitäisi kääntää jotenkin merkitykselliselle kielelle ja sopivasti jotain systeemiä miettimällä varmasti löytyisi jotain kiinnostavaa. Sitten kiisteltäisiin mitä järkeä on kyseisessä algoritmissa ja kielen merkityksessä jos jotain löytyisi. En itse olisi ainakaan vakuuttunut, samaa jumalan loittonemista ja etsimistä kuin kvanttikohinasta.

Genomista löytyy kyllä nykyäänkin sanoja, jos vaikka katsoo 1-kirjaimisia aminohapposekvenssejä.

Aika selvä viesti täytyisi olla. Aina saadaan randomilla arpomalla sieltä viestejä esiin etc. mutta se että kaveri viittis tulla ihan silleen vaikka laittaa jonkun alkudemon tohon syntymän paikkeille sillee et "Moi oon Jumala." ja sit jotain maisemia ja mahtipontista musaa niin olis homma paljon selvempi!

analyysi

Olen silloin tällöin törmännyt sellaisen vaatimuksen esittämiseen, että (jos geneettistä koodia on suunniteltu,) suunnittelijan olisi pitänyt kirjoittaa signeerauksensa geneettiseen koodiin, esim. tyyliin "made by God" tms.

Vaatimuksena todisteeksi suunnittelusta esitetään siis usein tällöin, että pitäisi löytää jokin edellä mainitun kaltainen teksti geneettisestä koodista.

Kysynkin nyt - etenkin niiltä, jotka edellä mainittua vaatimusta pitävät oikeutettuna - että
kelpaisiko tämän näköinen koodi(?):

GGCGUGAACAAUGUCCCAUGAGACGUAUGCACUGCUGAAACCAGUGAUGCCAAGUAAUGUCGAGA
AACUGCUUUCACAUUCUCUUUUAGAUGUGCCAGUGCCCCAUGACCGACGUAUUCUGCCCAAUGGAC
GCGUUUCUACAAUUAACACACUGCCCCAUGUAAUUCCACAUUCAAGUCCUUUUCCAUUUCUUCCACUA

JOS EI, MIKSI EI?

Ensinnäkin, tuo on RNA:ta. Aika harvan organismin genomi on RNA:ta, paitsi esim. HI-viruksen, joten herää kysymys, mistä eliöstä tämä sekvenssi olisi peräisin. Aika ketku Jumala olisi, jos pelkästään HIV:in omaksensa tunnustaisi?? (Viesti voisi olla vaikka: JAHVELTA TERKKUJA: HAJOTKAA TÄHÄN, LUUSERIT)

Toisekseenkin, sekvenssistä löytyy ainakin yksi avoin lukukehys proteiinille, jonka aminohappojärjestys on:

3'5' Frame 2
S G R N G K G L E C G I T W G S V L I V E T R P L G R I R R S W G T G T S K R E C E S S F S T L L G I T G F S S A Y V S W D I V H A

Tuollaista proteiinia ei löydy BLAST-haulla tietokannoista, mutta proteiinia koodaava DNA on tuskin hyvä salaisten viestien säilytyspaikka, koska niihin vaikuttaa luonnonvalinta. Kyseessä voi pelkästään olla ennestään tuntematon geeni. Ainakin pitäisi selvittää, onko tuo proteiini voinut syntyä luonnonvalinnan kautta.

Kolmanneksi, jos epäillään tuossa pätkässä jotain salaista viestiä olevan, kannattaisi varmaan katsoa onko sekvenssi niin epätodennäköinen, ettei se voisi tulla vastaan sattumalta (jos tarkastellaan kaikkien maailman eliöiden kaikkea DNA:ta).

On mahdollista, että ihmisen ja kaikkien muidenkin lajien perimästä löytyy kosminen tuoteseloste tai muuta hauskaa. Ongelma on siinä että mokoma on mahdoton todistaa oikeaksi tai vääräksi, ainakin ennenkuin saavutamme täydellisen ymmärryksen DNA:sta.

Tarkoitus olisi lähitulevaisuudessa palata tähän aiemmin esittämääni kysymykseen. Niillä, jotka eivät vielä ole vastanneet ja jotka haluavat ottaa asiaan vielä kantaa, on nyt aikaa vielä pari viikkoa vastailla ennen kuin kerron oman näkökantani asiaan.

(Äänestys tässä ketjussa taisi jo päättyä, joten vastauksia kyselyyn voi antaa ilmeisesti enää kirjallisesti.)

Kysymyshän kuului näin:

Olen silloin tällöin törmännyt sellaisen vaatimuksen esittämiseen, että (jos geneettistä koodia on suunniteltu,) suunnittelijan olisi pitänyt kirjoittaa signeerauksensa geneettiseen koodiin...

...kelpaisiko tämän näköinen koodi(?):

GGCGUGAACAAUGUCCCAUGAGACGUAUGCACUGCUGAAACCAGUGAUGCCAAGUAAUGUCGAGA
AACUGCUUUCACAUUCUCUUUUAGAUGUGCCAGUGCCCCAUGACCGACGUAUUCUGCCCAAUGGAC
GCGUUUCUACAAUUAACACACUGCCCCAUGUAAUUCCACAUUCAAGUCCUUUUCCAUUUCUUCCACUA

JOS EI, MIKSI EI?

Cosmic-Fairy
Jos itse suunnittelisin elämää niin en pistäisi signeereusta työhöni.

Onko tuo koodinpätkäsi edes aito vai ihan vaan heitetty?


Kuten kerroin, palaan lähitulevaisuudessa asiaan.
Silloin tulee vastaus varmaan tuohonkin kysymykseen.

analyysi
Cosmic-Fairy
Jos itse suunnittelisin elämää niin en pistäisi signeereusta työhöni.

Onko tuo koodinpätkäsi edes aito vai ihan vaan heitetty?


Kuten kerroin, palaan lähitulevaisuudessa asiaan.
Silloin tulee vastaus varmaan tuohonkin kysymykseen.

Sen verran olen ymmärtänyt asiasta, että jokaista proteiinia koodaavassa sekvenssissä (ihmisen 48 erilaisessa DNA puolikkaassa) on tietty pätkä joka ilmoittaa ”geenin” alkua. Tätä geenin alkua perinnöllisyystieteilijät tietääkseni hyvin tunnistavat.

Kyllä pidän geneettistä informaatiota elävässä solussa alun perin tarkalleen suunniteltuna, meidän kaltaiselle vesiplaneetalle ja auringolle.

HSTa
analyysi
Cosmic-Fairy
Jos itse suunnittelisin elämää niin en pistäisi signeereusta työhöni.

Onko tuo koodinpätkäsi edes aito vai ihan vaan heitetty?


Kuten kerroin, palaan lähitulevaisuudessa asiaan.
Silloin tulee vastaus varmaan tuohonkin kysymykseen.



Sen verran olen ymmärtänyt asiasta, että jokaista proteiinia koodaavassa sekvenssissä (ihmisen 48 erilaisessa DNA puolikkaassa) on tietty pätkä joka ilmoittaa ”geenin” alkua. Tätä geenin alkua perinnöllisyystieteilijät tietääkseni hyvin tunnistavat.

Kyllä pidän geneettistä informaatiota elävässä solussa alun perin tarkalleen suunniteltuna, meidän kaltaiselle vesiplaneetalle ja auringolle.


Miksi tätä ketjua on kaksi täysin samalla nimellä?

”ATG” ilmoitta ilmeseiti yleensä DNA geenin alkua, joskus loppua!? Vai tarkoittaako se että tätä loppukoodilla alkavaa on luettava toiseen suuntaan?

*When within gene; at beginning of gene, ATG signals start of translation.
Exceptions to the Code
The genetic code is almost universal. The same codons are assigned to the same amino acids and to the same START and STOP signals in the vast majority of genes in animals, plants, and microorganisms. However, some exceptions have been found. Most of these involve assigning one or two of the three STOP codons to an amino acid instead.

HSTa
Sen verran olen ymmärtänyt asiasta, että jokaista proteiinia koodaavassa sekvenssissä (ihmisen 48 erilaisessa DNA puolikkaassa) on tietty pätkä joka ilmoittaa ”geenin” alkua. Tätä geenin alkua perinnöllisyystieteilijät tietääkseni hyvin tunnistavat.

Kyllä pidän geneettistä informaatiota elävässä solussa alun perin tarkalleen suunniteltuna, meidän kaltaiselle vesiplaneetalle ja auringolle.

Varsin erikoinen keskustelu. Sellainen pieni huolimattomuusvirhe, että ihmisillä on soluissaan 46 erilaisat DNA juostetta, kun komplementaarisia ei lasketa. Tämä tuskin sinänsä vaikuttaa keskusteluun millään lailla mutta huomautinpa nyt kumminkin.

Noin pitkässä DNA jaksosa olisi varmaan tapahtunut lajien kehityksen aikana lukuisia mutaatioita, joilloin viestistä olisi tullut pelkkää sian saksaa - ellei sitten master mind olisi ohjannut mutatioita jotenkin, jolloin se oikea teksti olisi luettavissa vain tietyistä lajeista. Mutta miksi se suunnittelija olisi alunperin luonut niin alkukantaista porukkaa lainkaan. Ekiö olisi parempi ollut tehdä vain paras versio ja se siitä. Entä mitä varten sitten olisivat kaikki ne miljoonat perskärpäset, puhumattakaan viruksista ja bakuista. Voisiko olla, että kaikki nämä muut eliömuodot olivat harjoittelukappaleita, joita sitten ei haluttu hävittää. Parempi kysymys olisi ollut, että suunnitteliko joku DNA / RNA kaltaisen molekyylin, joka syntyy alkuaineista, voi kopioida itseään ja muuntua niin monella tavalla. Tästä kyllä on selvät todisteet kaikkine rotikaisineen, mutta se suunnittelija itse vain ei ole ilmoittautunut.

Sivut

Suosituimmat

Uusimmat

Sisältö jatkuu mainoksen alla

Suosituimmat